Transcript: Mouse XM_011248444.1

PREDICTED: Mus musculus BTG3 associated nuclear protein (Banp), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Banp (53325)
Length:
2011
CDS:
70..1464

Additional Resources:

NCBI RefSeq record:
XM_011248444.1
NBCI Gene record:
Banp (53325)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084821 ACTCTATTAACCAGACGATAT pLKO.1 242 CDS 100% 10.800 15.120 N Banp n/a
2 TRCN0000301965 ACTCTATTAACCAGACGATAT pLKO_005 242 CDS 100% 10.800 15.120 N Banp n/a
3 TRCN0000084820 CCAGACGATATGTTTGCGGTT pLKO.1 252 CDS 100% 2.160 3.024 N Banp n/a
4 TRCN0000304582 ACAGACAAGAACTACGATATT pLKO_005 1693 3UTR 100% 13.200 9.240 N Banp n/a
5 TRCN0000304544 CCAGCGACTAGAGATCAATTG pLKO_005 192 CDS 100% 10.800 7.560 N Banp n/a
6 TRCN0000084822 CGATGAGAATAACCCTGAGAT pLKO.1 636 CDS 100% 4.950 3.465 N Banp n/a
7 TRCN0000301901 CGATGAGAATAACCCTGAGAT pLKO_005 636 CDS 100% 4.950 3.465 N Banp n/a
8 TRCN0000084818 CTCTCTTGCTTCAGCAAGCAA pLKO.1 1528 3UTR 100% 0.300 0.210 N Banp n/a
9 TRCN0000015008 CCAACCAACCAACCAACCAAA pLKO.1 1797 3UTR 100% 4.950 2.475 Y HMBOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08437 pDONR223 100% 86.3% 95% None (many diffs) n/a
2 ccsbBroad304_08437 pLX_304 0% 86.3% 95% V5 (many diffs) n/a
3 TRCN0000479214 AAACTCTGCCCGCTTAAGGGGGTG pLX_317 21.9% 86.3% 95% V5 (many diffs) n/a
Download CSV