Construct: ORF TRCN0000479214
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006268.1_s317c1
- Derived from:
- ccsbBroadEn_08437
- DNA Barcode:
- AAACTCTGCCCGCTTAAGGGGGTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BANP (54971)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479214
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54971 | BANP | BTG3 associated nuclear pro... | NM_017869.4 | 99.8% | 100% | 651C>T;666C>A |
| 2 | human | 54971 | BANP | BTG3 associated nuclear pro... | NM_001173541.2 | 99.2% | 99.3% | 651C>T;666C>A;1083_1084insATCCCACAG |
| 3 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450326.1 | 99.2% | 99.3% | 651C>T;666C>A;1083_1084insATCCCACAG |
| 4 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_017023381.1 | 97.9% | 97.8% | (many diffs) |
| 5 | human | 54971 | BANP | BTG3 associated nuclear pro... | NM_079837.3 | 95.3% | 95.5% | 651C>T;666C>A;1192_1257del |
| 6 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_017023380.2 | 94.7% | 94.9% | (many diffs) |
| 7 | human | 54971 | BANP | BTG3 associated nuclear pro... | NM_001173540.2 | 94.2% | 94.1% | (many diffs) |
| 8 | human | 54971 | BANP | BTG3 associated nuclear pro... | NM_001173542.1 | 92.1% | 92.3% | 363_479del;768C>T;783C>A |
| 9 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_005256009.4 | 92.1% | 92.3% | 363_479del;768C>T;783C>A |
| 10 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450323.1 | 92.1% | 92.3% | 363_479del;768C>T;783C>A |
| 11 | human | 54971 | BANP | BTG3 associated nuclear pro... | NM_001173539.2 | 91.6% | 91.7% | (many diffs) |
| 12 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450324.1 | 91.6% | 91.7% | (many diffs) |
| 13 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_005256008.3 | 91.1% | 91% | (many diffs) |
| 14 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_011523181.2 | 90.5% | 90.4% | (many diffs) |
| 15 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_011523179.3 | 88.3% | 88.4% | (many diffs) |
| 16 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_011523180.2 | 88.3% | 88.4% | (many diffs) |
| 17 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_017023379.2 | 87.7% | 87.9% | (many diffs) |
| 18 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450320.1 | 87.7% | 87.9% | (many diffs) |
| 19 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450321.1 | 87.7% | 87.9% | (many diffs) |
| 20 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450322.1 | 87.7% | 87.9% | (many diffs) |
| 21 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_011523170.2 | 87.3% | 87.3% | (many diffs) |
| 22 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_011523172.2 | 87.3% | 87.3% | (many diffs) |
| 23 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_011523174.2 | 87.3% | 87.3% | (many diffs) |
| 24 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_011523175.3 | 87.3% | 87.3% | (many diffs) |
| 25 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_011523176.2 | 87.3% | 87.3% | (many diffs) |
| 26 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_011523177.2 | 87.3% | 87.3% | (many diffs) |
| 27 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_017023378.1 | 87.3% | 87.3% | (many diffs) |
| 28 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_011523178.2 | 86.8% | 86.7% | (many diffs) |
| 29 | human | 54971 | BANP | BTG3 associated nuclear pro... | NM_001173543.1 | 86.2% | 86.4% | (many diffs) |
| 30 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450325.1 | 81.7% | 76.5% | (many diffs) |
| 31 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_011523182.1 | 77.5% | 77.4% | (many diffs) |
| 32 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_011523184.2 | 76.1% | 72% | (many diffs) |
| 33 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450328.1 | 76.1% | 72% | (many diffs) |
| 34 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450329.1 | 74.4% | 74.5% | (many diffs) |
| 35 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450330.1 | 73.7% | 73.9% | (many diffs) |
| 36 | human | 54971 | BANP | BTG3 associated nuclear pro... | XR_933350.2 | 71.9% | (many diffs) | |
| 37 | human | 54971 | BANP | BTG3 associated nuclear pro... | XR_933352.2 | 71.4% | (many diffs) | |
| 38 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_011523183.2 | 68.9% | 69% | (many diffs) |
| 39 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450327.1 | 68.9% | 69% | (many diffs) |
| 40 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_017023382.1 | 62.3% | 58.6% | (many diffs) |
| 41 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_017023383.2 | 57.6% | 57.7% | (many diffs) |
| 42 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450334.1 | 57.6% | 57.7% | (many diffs) |
| 43 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450331.1 | 55.6% | 55.8% | (many diffs) |
| 44 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450332.1 | 55.6% | 55.8% | (many diffs) |
| 45 | human | 54971 | BANP | BTG3 associated nuclear pro... | XM_024450333.1 | 55.6% | 55.8% | (many diffs) |
| 46 | human | 440352 | SNX29P2 | sorting nexin 29 pseudogene 2 | NR_002939.3 | 39.8% | (many diffs) | |
| 47 | mouse | 53325 | Banp | BTG3 associated nuclear pro... | XM_011248444.1 | 86.3% | 95% | (many diffs) |
| 48 | mouse | 53325 | Banp | BTG3 associated nuclear pro... | XM_011248442.1 | 80.2% | 88.3% | (many diffs) |
| 49 | mouse | 53325 | Banp | BTG3 associated nuclear pro... | NM_001285981.1 | 79.9% | 87.8% | (many diffs) |
| 50 | mouse | 53325 | Banp | BTG3 associated nuclear pro... | XM_011248443.2 | 79.6% | 87.7% | (many diffs) |
| 51 | mouse | 53325 | Banp | BTG3 associated nuclear pro... | NM_001285983.1 | 79.3% | 87.2% | (many diffs) |
| 52 | mouse | 53325 | Banp | BTG3 associated nuclear pro... | NM_016812.4 | 74.2% | 81.6% | (many diffs) |
| 53 | mouse | 53325 | Banp | BTG3 associated nuclear pro... | XM_017312899.1 | 74.2% | 81.6% | (many diffs) |
| 54 | mouse | 53325 | Banp | BTG3 associated nuclear pro... | NM_001110100.2 | 73.7% | 81% | (many diffs) |
| 55 | mouse | 53325 | Banp | BTG3 associated nuclear pro... | XM_011248445.1 | 46.6% | 51% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1473
- ORF length:
- 1407
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat gtcggaacac gacctggccg atgtggttca gattgcagtg gaagacctga 121 gccctgacca cccagttgtt ttggagaatc atgtagtgac agatgaagac gaacctgctt 181 tgaaacgcca gcgactagaa atcaattgcc aggatccatc tataaagtca ttcctgtatt 241 ccatcaacca gacaatctgc ttgcggttgg atagcattga agccaaattg caagccctgg 301 aggctacttg taaatcctta gaagaaaagc tggatctggt cacgaacaag cagcacagcc 361 ccatccaggt ccccatggtg gccggctccc ctctcggggc aacccagacg tgcaacaaag 421 tgcgatgcgc tgtgcctggg cgtcggcaga acaccattgt ggtgaaggtg ccgggccaag 481 aagacagcca ccacgaggac ggggagagcg gctcggaggc cagcgactct gtgtccagct 541 gtgggcaggc gggcagtcag agcatcggga gcaacgtcac gctcatcacc ctgaactcgg 601 aagaggacta ccccaatggc acctggctgg gcgacgagaa caaccccgag atgcgggtac 661 gctgcgccat catcccctcc gacatgctgc acatcagcac caactgccgc acggctgaga 721 agatggcgct aacgctgctg gactacctct tccaccgcga ggtgcaggct gtgtccaacc 781 tctcggggca gggcaagcac gggaagaagc agctggaccc gctcaccatc tacggcatcc 841 ggtgtcacct tttctataaa tttggcatca cagaatccga ctggtaccga atcaagcaga 901 gcatcgactc caagtgccgc acggcgtggc ggcgcaagca gcggggccag agcctggcgg 961 tcaagagctt ctcgcggaga acgcccaact cgtcctccta ctgcccttca gagccgatga 1021 tgagcacccc acctcctgcc agcgagctcc cgcagccaca gccgcagccg caggccctgc 1081 actacgcgct ggccaacgca cagcaggtgc agatccacca gatcggagaa gacggacagg 1141 tgcaagtaat cccacaggga cacctccaca TCGCCCAGGT GCCGCAGGGG GAGCAAGTCC 1201 AGATCACGCA GGACAGCGAG GGCAACCTCC AGATCCATCA CGTGGGGCAG GACGGTCAGG 1261 TGCTGCAGGG TGCACAGCTG ATCGCCGTGG CCTCCTCGGA CCCCGCGGCG GCGGGCGTGG 1321 ATGGGTCGCC ACTCCAGGGC AGCGACATCC AGGTTCAGTA CGTGCAGCTG GCGCCAGTGA 1381 GTGACCACAC GGCCGGGGCA CAGACGGCCG AAGCCCTGCA GCCCACGCTA CAGCCGGAGA 1441 TGCAGCTCGA GCACGGGGCC ATCCAGATTC AGTGCCCAAC TTTCTTGTAC AAAGTGGTTG 1501 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1561 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAA 1621 ACTCTGCCCG CTTAAGGGGG TGACGCGTTA AGTCgacaat caacctctgg attacaaaat 1681 ttgtgaaaga tt