Transcript: Mouse XM_011248445.1

PREDICTED: Mus musculus BTG3 associated nuclear protein (Banp), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Banp (53325)
Length:
1563
CDS:
72..1016

Additional Resources:

NCBI RefSeq record:
XM_011248445.1
NBCI Gene record:
Banp (53325)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304582 ACAGACAAGAACTACGATATT pLKO_005 1245 3UTR 100% 13.200 9.240 N Banp n/a
2 TRCN0000084819 GCCTGCTGGAAATGAAATGAT pLKO.1 776 CDS 100% 5.625 3.938 N Banp n/a
3 TRCN0000301899 GCCTGCTGGAAATGAAATGAT pLKO_005 776 CDS 100% 5.625 3.938 N Banp n/a
4 TRCN0000084822 CGATGAGAATAACCCTGAGAT pLKO.1 53 5UTR 100% 4.950 3.465 N Banp n/a
5 TRCN0000301901 CGATGAGAATAACCCTGAGAT pLKO_005 53 5UTR 100% 4.950 3.465 N Banp n/a
6 TRCN0000084818 CTCTCTTGCTTCAGCAAGCAA pLKO.1 1080 3UTR 100% 0.300 0.210 N Banp n/a
7 TRCN0000015008 CCAACCAACCAACCAACCAAA pLKO.1 1349 3UTR 100% 4.950 2.475 Y HMBOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08437 pDONR223 100% 46.6% 51% None (many diffs) n/a
2 ccsbBroad304_08437 pLX_304 0% 46.6% 51% V5 (many diffs) n/a
3 TRCN0000479214 AAACTCTGCCCGCTTAAGGGGGTG pLX_317 21.9% 46.6% 51% V5 (many diffs) n/a
Download CSV