Transcript: Mouse XM_011248560.2

PREDICTED: Mus musculus zinc finger protein 423 (Zfp423), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp423 (94187)
Length:
4927
CDS:
321..4259

Additional Resources:

NCBI RefSeq record:
XM_011248560.2
NBCI Gene record:
Zfp423 (94187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084712 CGTGGAAGATGAGTCAATTTA pLKO.1 584 CDS 100% 15.000 10.500 N Zfp423 n/a
2 TRCN0000274364 GAACATTACATCCAATCAAAG pLKO_005 4325 3UTR 100% 10.800 7.560 N ZNF423 n/a
3 TRCN0000084708 CCCTGAATGTAACGTGAAGTT pLKO.1 3770 CDS 100% 4.950 3.465 N Zfp423 n/a
4 TRCN0000084709 CGGTGCATTACATGACTACAT pLKO.1 2449 CDS 100% 4.950 3.465 N Zfp423 n/a
5 TRCN0000084710 CGCAGATGATAGGAGATGGTT pLKO.1 751 CDS 100% 3.000 2.100 N Zfp423 n/a
6 TRCN0000084711 CGACCTCAAGTTCTCCAACTT pLKO.1 2315 CDS 100% 0.495 0.347 N Zfp423 n/a
7 TRCN0000274366 AGTCCTTCATGGAGGTCTATT pLKO_005 2074 CDS 100% 13.200 9.240 N ZNF423 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07835 pDONR223 100% 89.6% 95.8% None (many diffs) n/a
2 ccsbBroad304_07835 pLX_304 0% 89.6% 95.8% V5 (many diffs) n/a
3 TRCN0000473266 GCCTACTCAAGCGCAAGCGAATGC pLX_317 13% 89.6% 95.8% V5 (many diffs) n/a
Download CSV