Transcript: Mouse XM_011248618.1

PREDICTED: Mus musculus sorting nexin 32 (Snx32), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snx32 (225861)
Length:
1868
CDS:
664..1692

Additional Resources:

NCBI RefSeq record:
XM_011248618.1
NBCI Gene record:
Snx32 (225861)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178635 CGGAATACTTGGCCATCTTTA pLKO.1 683 CDS 100% 13.200 9.240 N Snx32 n/a
2 TRCN0000200216 CCAGGAAGTCAACCAACTCAA pLKO.1 1071 CDS 100% 4.950 3.465 N Snx32 n/a
3 TRCN0000182592 GAAGAACAGGAAGGAGGTCTT pLKO.1 822 CDS 100% 4.050 2.835 N Snx32 n/a
4 TRCN0000182166 CCCTATAAAGACGCTCTCCTT pLKO.1 1593 CDS 100% 2.640 1.848 N Snx32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16135 pDONR223 0% 54.4% 36.6% None (many diffs) n/a
2 ccsbBroad304_16135 pLX_304 0% 54.4% 36.6% V5 (many diffs) n/a
3 TRCN0000471625 CGAGCCCGAAAGTTCCTGTAATAT pLX_317 39.4% 54.4% 36.6% V5 (many diffs) n/a
4 ccsbBroadEn_09895 pDONR223 100% 54.2% 36.5% None (many diffs) n/a
5 ccsbBroad304_09895 pLX_304 0% 54.2% 36.5% V5 (many diffs) n/a
6 TRCN0000467330 AACTCGTTTTTGTACTACGACACG pLX_317 33.2% 54.2% 36.5% V5 (many diffs) n/a
Download CSV