Transcript: Mouse XM_011248675.2

PREDICTED: Mus musculus adrenergic receptor, alpha 1b (Adra1b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adra1b (11548)
Length:
3727
CDS:
925..2472

Additional Resources:

NCBI RefSeq record:
XM_011248675.2
NBCI Gene record:
Adra1b (11548)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027320 GCGCCCAATGACGACAAAGAA pLKO.1 1486 CDS 100% 5.625 7.875 N Adra1b n/a
2 TRCN0000452687 CGCCGTATTCAAGGTAGTGTT pLKO_005 1905 CDS 100% 4.950 6.930 N Adra1b n/a
3 TRCN0000447947 GCCTATGTGCCATCTCCATTG pLKO_005 1328 CDS 100% 6.000 4.800 N Adra1b n/a
4 TRCN0000027387 CCTCTCCTTGGATGGAAAGAA pLKO.1 1462 CDS 100% 5.625 3.938 N Adra1b n/a
5 TRCN0000027382 CCTGAGAATCCACTCTAAGAA pLKO.1 1680 CDS 100% 5.625 3.938 N Adra1b n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3297 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487719 CCAGTAACCCTTTATCGGCGTGAA pLX_317 17.8% 89.8% 95.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV