Transcript: Mouse XM_011248885.1

PREDICTED: Mus musculus zinc finger protein 354A (Zfp354a), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp354a (21408)
Length:
4032
CDS:
386..2104

Additional Resources:

NCBI RefSeq record:
XM_011248885.1
NBCI Gene record:
Zfp354a (21408)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248885.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430883 GATGTGAATGCCTCGACTATA pLKO_005 794 CDS 100% 13.200 10.560 N Zfp354a n/a
2 TRCN0000085062 CCCTGTATAAACATCTAAGAA pLKO.1 1146 CDS 100% 5.625 4.500 N Zfp354a n/a
3 TRCN0000085060 CGGATAGCACATCAGCGAATT pLKO.1 1979 CDS 100% 0.000 0.000 N Zfp354a n/a
4 TRCN0000417554 AGACCTTGACTTCAGGTATTT pLKO_005 2438 3UTR 100% 13.200 9.240 N Zfp354a n/a
5 TRCN0000329891 CAAACACAAGACTCTTCATTT pLKO_005 677 CDS 100% 13.200 9.240 N ZNF354A n/a
6 TRCN0000085061 CATCCCTGTATAAACATCTAA pLKO.1 1143 CDS 100% 5.625 3.938 N Zfp354a n/a
7 TRCN0000085059 GCCCAAAGTCACATAGAGAAA pLKO.1 843 CDS 100% 4.950 3.465 N Zfp354a n/a
8 TRCN0000085058 GCTGGACTTCTCAGTAGCAAA pLKO.1 2540 3UTR 100% 4.950 3.465 N Zfp354a n/a
9 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 2005 CDS 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248885.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07038 pDONR223 100% 80.8% 81.7% None (many diffs) n/a
2 ccsbBroad304_07038 pLX_304 0% 80.8% 81.7% V5 (many diffs) n/a
3 TRCN0000478640 TACATCAATAACCCCTTTTATCCG pLX_317 16% 80.8% 81.7% V5 (many diffs) n/a
Download CSV