Transcript: Mouse XM_011248906.2

PREDICTED: Mus musculus target of myb1-like 2 (chicken) (Tom1l2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tom1l2 (216810)
Length:
5068
CDS:
104..1690

Additional Resources:

NCBI RefSeq record:
XM_011248906.2
NBCI Gene record:
Tom1l2 (216810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248906.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102150 GCTGGAGACTTGTGTGAAGAA pLKO.1 322 CDS 100% 4.950 3.960 N Tom1l2 n/a
2 TRCN0000065326 GTCAACGATGACCTCAACAAT pLKO.1 974 CDS 100% 5.625 3.938 N TOM1L2 n/a
3 TRCN0000102152 CAAGAATAACCCTCCCACTAT pLKO.1 418 CDS 100% 4.950 3.465 N Tom1l2 n/a
4 TRCN0000102151 CGTCAACGATGACCTCAACAA pLKO.1 973 CDS 100% 4.950 3.465 N Tom1l2 n/a
5 TRCN0000102153 TCACAAGTGAAGAGTTCGATA pLKO.1 1530 CDS 100% 4.950 3.465 N Tom1l2 n/a
6 TRCN0000102154 CCAAGAATAACCCTCCCACTA pLKO.1 417 CDS 100% 4.050 2.835 N Tom1l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248906.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04992 pDONR223 100% 76.1% 81.8% None (many diffs) n/a
2 ccsbBroad304_04992 pLX_304 0% 76.1% 81.8% V5 (many diffs) n/a
3 TRCN0000477805 TACATTACAGCGACGATCTTTAAA pLX_317 22.4% 76.1% 81.8% V5 (many diffs) n/a
Download CSV