Transcript: Mouse XM_011249167.2

PREDICTED: Mus musculus ras homolog family member T1 (Rhot1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rhot1 (59040)
Length:
4013
CDS:
216..2378

Additional Resources:

NCBI RefSeq record:
XM_011249167.2
NBCI Gene record:
Rhot1 (59040)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337573 CAACACACATTGTCGATTATT pLKO_005 409 CDS 100% 15.000 21.000 N Rhot1 n/a
2 TRCN0000306169 GATATCTCAGAGTCGGAATTT pLKO_005 1677 CDS 100% 13.200 18.480 N Rhot1 n/a
3 TRCN0000077742 CCTACTTAGATGTGCAGCGTT pLKO.1 1363 CDS 100% 2.640 3.696 N Rhot1 n/a
4 TRCN0000311476 GATGATCATAAGTCCTATTAT pLKO_005 1605 CDS 100% 15.000 10.500 N Rhot1 n/a
5 TRCN0000337509 CAGCGTTGCCTGGAGTATTTG pLKO_005 1377 CDS 100% 13.200 9.240 N Rhot1 n/a
6 TRCN0000077741 CCAACACACATTGTCGATTAT pLKO.1 408 CDS 100% 13.200 9.240 N Rhot1 n/a
7 TRCN0000077738 GCCAAATATAAGTGGCTAAAT pLKO.1 2571 3UTR 100% 13.200 9.240 N Rhot1 n/a
8 TRCN0000330651 TGGACTGTGCTTCGACGATTT pLKO_005 1056 CDS 100% 10.800 7.560 N RHOT1 n/a
9 TRCN0000077739 GCTCAACTTCTTCCAGAGAAT pLKO.1 878 CDS 100% 4.950 3.465 N Rhot1 n/a
10 TRCN0000326200 GCTCAACTTCTTCCAGAGAAT pLKO_005 878 CDS 100% 4.950 3.465 N Rhot1 n/a
11 TRCN0000077740 CCTGCTTGATTGTAGCTGCAA pLKO.1 1816 CDS 100% 2.640 1.848 N Rhot1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15895 pDONR223 0% 79.2% 84% None (many diffs) n/a
2 ccsbBroad304_15895 pLX_304 0% 79.2% 84% V5 (many diffs) n/a
3 TRCN0000470433 CATTGAGCAGTGACATAAGTATGG pLX_317 21.6% 79.2% 84% V5 (many diffs) n/a
Download CSV