Transcript: Mouse XM_011249234.2

PREDICTED: Mus musculus solute carrier family 39 (metal ion transporter), member 11 (Slc39a11), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc39a11 (69806)
Length:
2807
CDS:
141..1241

Additional Resources:

NCBI RefSeq record:
XM_011249234.2
NBCI Gene record:
Slc39a11 (69806)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079581 TCTTGCTGTTGGCGTAGGATT pLKO.1 839 CDS 100% 4.950 6.930 N Slc39a11 n/a
2 TRCN0000079582 GCGTGAGAATGGCGAGGTATA pLKO.1 668 CDS 100% 10.800 7.560 N Slc39a11 n/a
3 TRCN0000429192 GTGAACTTTCCATCCGGATAG pLKO_005 622 CDS 100% 6.000 4.200 N SLC39A11 n/a
4 TRCN0000079580 CGTGGTCATGGATGACATCAT pLKO.1 1124 CDS 100% 4.950 3.465 N Slc39a11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09814 pDONR223 100% 78.9% 82.8% None (many diffs) n/a
2 ccsbBroad304_09814 pLX_304 0% 78.9% 82.8% V5 (many diffs) n/a
3 TRCN0000480061 CTTTACTTATTCTCTTCTATATTC pLX_317 31.7% 78.9% 82.8% V5 (many diffs) n/a
Download CSV