Transcript: Mouse XM_011249287.2

PREDICTED: Mus musculus tetratricopeptide repeat domain 25 (Ttc25), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttc25 (74407)
Length:
2105
CDS:
143..1663

Additional Resources:

NCBI RefSeq record:
XM_011249287.2
NBCI Gene record:
Ttc25 (74407)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251147 TCGAGAGCCCTTGACAATATT pLKO_005 1214 CDS 100% 15.000 21.000 N Ttc25 n/a
2 TRCN0000251151 TCTATCATCGAGGCTACAAAC pLKO_005 444 CDS 100% 10.800 15.120 N Ttc25 n/a
3 TRCN0000251149 ACAGAAGCATCTGCCTATAAA pLKO_005 610 CDS 100% 15.000 10.500 N Ttc25 n/a
4 TRCN0000251150 GACCGTGGAGGACCTCATTAT pLKO_005 793 CDS 100% 13.200 9.240 N Ttc25 n/a
5 TRCN0000420477 TGTACACCATGGGAGACTTTG pLKO_005 408 CDS 100% 10.800 7.560 N TTC25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12739 pDONR223 100% 66.2% 67.5% None (many diffs) n/a
2 ccsbBroad304_12739 pLX_304 0% 66.2% 67.5% V5 (many diffs) n/a
3 TRCN0000472420 GCCCCCCCCAGCTGCCACAGACGA pLX_317 21.5% 66.2% 67.5% V5 (many diffs) n/a
4 ccsbBroadEn_16019 pDONR223 0% 49.5% 37.1% None (many diffs) n/a
5 ccsbBroad304_16019 pLX_304 0% 49.5% 37.1% V5 (many diffs) n/a
6 TRCN0000475592 TCTGGAGCACATATAGTTGACCCC pLX_317 28.2% 49.5% 37.1% V5 (many diffs) n/a
Download CSV