Transcript: Mouse XM_011249309.2

PREDICTED: Mus musculus jade family PHD finger 2 (Jade2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Jade2 (76901)
Length:
6571
CDS:
638..3127

Additional Resources:

NCBI RefSeq record:
XM_011249309.2
NBCI Gene record:
Jade2 (76901)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417756 ATTACCAAGATCTCGCATATT pLKO_005 1523 CDS 100% 13.200 18.480 N Jade2 n/a
2 TRCN0000103900 CGGACTATATTAGCTGACAAT pLKO.1 1673 CDS 100% 4.950 6.930 N Jade2 n/a
3 TRCN0000359623 GGCCTGGAAATGCGGACTATA pLKO_005 1661 CDS 100% 13.200 10.560 N JADE2 n/a
4 TRCN0000103904 CCATCTACAGATGAAACTTAT pLKO.1 2149 CDS 100% 13.200 9.240 N Jade2 n/a
5 TRCN0000018514 GCCTGGAAATGCGGACTATAT pLKO.1 1662 CDS 100% 13.200 9.240 N JADE2 n/a
6 TRCN0000103903 CTGTCAGAGGAATTGCTACAA pLKO.1 2462 CDS 100% 4.950 3.465 N Jade2 n/a
7 TRCN0000103902 CCACATCAGCATCAAGATGTT pLKO.1 708 CDS 100% 0.495 0.347 N Jade2 n/a
8 TRCN0000103901 GCTTCCGACTTAAATGTCCAA pLKO.1 2816 CDS 100% 2.640 1.584 N Jade2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11722 pDONR223 100% 83% 86.5% None (many diffs) n/a
2 ccsbBroad304_11722 pLX_304 0% 83% 86.5% V5 (many diffs) n/a
3 TRCN0000472266 TAGGATTCGATGTGTTACGACTGG pLX_317 17.6% 83% 86.5% V5 (many diffs) n/a
Download CSV