Transcript: Mouse XM_011249320.2

PREDICTED: Mus musculus CDK5 regulatory subunit associated protein 3 (Cdk5rap3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdk5rap3 (80280)
Length:
1931
CDS:
267..1637

Additional Resources:

NCBI RefSeq record:
XM_011249320.2
NBCI Gene record:
Cdk5rap3 (80280)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249320.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243475 AGGGAAACTCGACGGTGTATG pLKO_005 820 CDS 100% 10.800 15.120 N Cdk5rap3 n/a
2 TRCN0000178253 GAAACTGATTGAAGCCGACAT pLKO.1 1565 CDS 100% 4.050 5.670 N Cdk5rap3 n/a
3 TRCN0000243472 TGCGGATGCAGCACCTGTTTA pLKO_005 1360 CDS 100% 13.200 10.560 N Cdk5rap3 n/a
4 TRCN0000217564 GAGAAGGACAACACCTATTTA pLKO.1 438 CDS 100% 15.000 10.500 N Cdk5rap3 n/a
5 TRCN0000243476 GAGAAGGACAACACCTATTTA pLKO_005 438 CDS 100% 15.000 10.500 N Cdk5rap3 n/a
6 TRCN0000243473 AGAATAGTGGACCTTCTTAAA pLKO_005 333 CDS 100% 13.200 9.240 N Cdk5rap3 n/a
7 TRCN0000197403 CAGAAGACACTGTAACCTAAA pLKO.1 191 5UTR 100% 10.800 7.560 N Cdk5rap3 n/a
8 TRCN0000243474 TTGGAGACAGAGCCATGAGGA pLKO_005 1741 3UTR 100% 2.640 1.848 N Cdk5rap3 n/a
9 TRCN0000177011 GAAACTCGGAATCAGTTCATT pLKO.1 1158 CDS 100% 5.625 2.813 Y Cdk5rap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249320.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09023 pDONR223 100% 78.5% 79.2% None (many diffs) n/a
2 ccsbBroad304_09023 pLX_304 0% 78.5% 79.2% V5 (many diffs) n/a
3 TRCN0000480634 TTTTTAAGTTTGGGACTATATTCT pLX_317 23% 78.5% 79.2% V5 (many diffs) n/a
Download CSV