Transcript: Mouse XM_011249478.1

PREDICTED: Mus musculus coiled-coil domain containing 158 (Ccdc158), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc158 (320696)
Length:
3701
CDS:
180..3521

Additional Resources:

NCBI RefSeq record:
XM_011249478.1
NBCI Gene record:
Ccdc158 (320696)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249478.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191195 CGATCAATCTTAGTTGACTTT pLKO.1 744 CDS 100% 4.950 6.930 N Ccdc158 n/a
2 TRCN0000200898 CCGTCATTAGAAACAACAGGA pLKO.1 3348 CDS 100% 2.640 3.696 N Ccdc158 n/a
3 TRCN0000191325 CAGAGGACTATGAAGTCTTAA pLKO.1 2194 CDS 100% 13.200 9.240 N Ccdc158 n/a
4 TRCN0000201387 GAGCTTCAACACCTGAAGAAT pLKO.1 1770 CDS 100% 0.563 0.394 N Ccdc158 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249478.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13593 pDONR223 100% 18% 16.3% None (many diffs) n/a
2 ccsbBroad304_13593 pLX_304 0% 18% 16.3% V5 (many diffs) n/a
3 TRCN0000475208 ACTTTGATCTAAAATTGAACCTTC pLX_317 52.3% 18% 16.3% V5 (many diffs) n/a
Download CSV