Transcript: Mouse XM_011249705.2

PREDICTED: Mus musculus TRAF2 and NCK interacting kinase (Tnik), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tnik (665113)
Length:
19369
CDS:
9388..13260

Additional Resources:

NCBI RefSeq record:
XM_011249705.2
NBCI Gene record:
Tnik (665113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249705.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025190 GCCGAACATGAGCAGGAATAT pLKO.1 10540 CDS 100% 13.200 18.480 N Tnik n/a
2 TRCN0000025191 CCATCCCATATTCAGGGCAAT pLKO.1 12835 CDS 100% 4.050 5.670 N Tnik n/a
3 TRCN0000199940 GCGAACTTCTTAGGCAAGAAC pLKO.1 12155 CDS 100% 0.495 0.693 N TNIK n/a
4 TRCN0000025193 CCCTGAAGAAAGTGACTGATT pLKO.1 11609 CDS 100% 4.950 3.465 N Tnik n/a
5 TRCN0000025189 CGAGGAAGATTTCAGTGGTAA pLKO.1 12194 CDS 100% 4.950 3.465 N Tnik n/a
6 TRCN0000037517 GCCTCAAAGAACAACTTCTAT pLKO.1 11151 CDS 100% 5.625 3.375 N TNIK n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1001 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249705.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492337 ACACGTCCGAGTCATCCTGCGGAC pLX_317 8.7% 85.4% 91% V5 (many diffs) n/a
Download CSV