Transcript: Mouse XM_011249850.2

PREDICTED: Mus musculus chitinase domain containing 1 (Chid1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chid1 (68038)
Length:
1136
CDS:
145..1119

Additional Resources:

NCBI RefSeq record:
XM_011249850.2
NBCI Gene record:
Chid1 (68038)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050754 CCTGTCAAAGTCAGATGCCAA pLKO.1 213 CDS 100% 2.640 2.112 N CHID1 n/a
2 TRCN0000276839 ATGATTTCCGAAACGTCTTAG pLKO_005 626 CDS 100% 10.800 7.560 N Chid1 n/a
3 TRCN0000198792 CAAGGTCTTTGGGAGCAAGTT pLKO.1 441 CDS 100% 4.950 3.465 N Chid1 n/a
4 TRCN0000276837 CAAGGTCTTTGGGAGCAAGTT pLKO_005 441 CDS 100% 4.950 3.465 N Chid1 n/a
5 TRCN0000178699 CAGAAACATGTAGGCCTCATT pLKO.1 751 CDS 100% 4.950 3.465 N Chid1 n/a
6 TRCN0000276899 CAGAAACATGTAGGCCTCATT pLKO_005 751 CDS 100% 4.950 3.465 N Chid1 n/a
7 TRCN0000181979 CTACGATGTTGCCAAGGTCTT pLKO.1 429 CDS 100% 4.050 2.835 N Chid1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04009 pDONR223 100% 70.3% 71.7% None (many diffs) n/a
2 ccsbBroad304_04009 pLX_304 0% 70.3% 71.7% V5 (many diffs) n/a
3 TRCN0000469757 TTAAGGTCAGACGTTCGTGTGGAT pLX_317 29.1% 70.3% 71.7% V5 (many diffs) n/a
Download CSV