Transcript: Mouse XM_011250030.2

PREDICTED: Mus musculus transmembrane protein 8B (Tmem8b), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem8b (242409)
Length:
4754
CDS:
1030..2448

Additional Resources:

NCBI RefSeq record:
XM_011250030.2
NBCI Gene record:
Tmem8b (242409)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269181 ATTAGAGTAACAGGTACAAAT pLKO_005 3349 3UTR 100% 13.200 10.560 N Tmem8b n/a
2 TRCN0000269150 TGATCAAGCAGGTGCTGTATC pLKO_005 1985 CDS 100% 10.800 8.640 N Tmem8b n/a
3 TRCN0000269126 TGATTTCCTGGGCTCCTTAAT pLKO_005 1920 CDS 100% 13.200 9.240 N Tmem8b n/a
4 TRCN0000269125 GGGACAACTACTTCTACATTC pLKO_005 2237 CDS 100% 10.800 7.560 N Tmem8b n/a
5 TRCN0000269124 GTTACCAGCTGTGCATCAATG pLKO_005 2363 CDS 100% 10.800 7.560 N Tmem8b n/a
6 TRCN0000141099 CATGTTCTTCTCCACGTTCTA pLKO.1 1833 CDS 100% 4.950 2.475 Y PGAP6 n/a
7 TRCN0000138947 GAGAGAGAGGAGAGAGAGAAA pLKO.1 3589 3UTR 100% 4.950 2.475 Y TVP23C n/a
8 TRCN0000139453 CACCATGTTCTTCTCCACGTT pLKO.1 1830 CDS 100% 2.640 1.320 Y PGAP6 n/a
9 TRCN0000154310 CTGTCCACTTCTACATCTTCT pLKO.1 1178 CDS 100% 4.950 3.465 N TMEM8B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08344 pDONR223 100% 58% 58.8% None (many diffs) n/a
2 ccsbBroad304_08344 pLX_304 0% 58% 58.8% V5 (many diffs) n/a
3 TRCN0000475160 TTTCTATAGAAACAAGTAGGGTAT pLX_317 20.7% 58% 58.8% V5 (many diffs) n/a
Download CSV