Transcript: Mouse XM_011250086.2

PREDICTED: Mus musculus Myb/SANT-like DNA-binding domain containing 3 (Msantd3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Msantd3 (66665)
Length:
5825
CDS:
359..1186

Additional Resources:

NCBI RefSeq record:
XM_011250086.2
NBCI Gene record:
Msantd3 (66665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200041 CGTCAGGATAACCGCCAATAA pLKO.1 880 CDS 100% 13.200 18.480 N Msantd3 n/a
2 TRCN0000216755 GATGGCTCCCTTGTAGTTAAT pLKO.1 1195 3UTR 100% 13.200 18.480 N Msantd3 n/a
3 TRCN0000176504 CGTGCTATAATTCTGAATGTA pLKO.1 1402 3UTR 100% 5.625 7.875 N Msantd3 n/a
4 TRCN0000150829 GAGTGGTAGTAGTCACTTATT pLKO.1 1292 3UTR 100% 13.200 10.560 N MSANTD3 n/a
5 TRCN0000426855 AGAGTGGTAGTAGTCACTTAT pLKO_005 1291 3UTR 100% 13.200 9.240 N Msantd3 n/a
6 TRCN0000437526 GGATGGCTCCCTTGTAGTTAA pLKO_005 1194 3UTR 100% 13.200 9.240 N Msantd3 n/a
7 TRCN0000216086 CACTTATTTAAGGATACATTC pLKO.1 1305 3UTR 100% 10.800 7.560 N Msantd3 n/a
8 TRCN0000177770 CTCAGGAAGGTGCTTTAAAGA pLKO.1 921 CDS 100% 5.625 3.938 N Msantd3 n/a
9 TRCN0000182581 GCTGCAGCTGATCCAAATGAA pLKO.1 985 CDS 100% 5.625 3.938 N Msantd3 n/a
10 TRCN0000446899 CCATCAGCAGATGTCCATCTT pLKO_005 961 CDS 100% 4.950 3.465 N Msantd3 n/a
11 TRCN0000182490 GAACTGTGCGAGGATGAGAAA pLKO.1 800 CDS 100% 4.950 3.465 N Msantd3 n/a
12 TRCN0000200299 GCAGATGTCCATCTTACAGCT pLKO.1 967 CDS 100% 2.640 1.848 N Msantd3 n/a
13 TRCN0000200439 GATCCAAATGAACGAGGTGCA pLKO.1 994 CDS 100% 2.160 1.512 N Msantd3 n/a
14 TRCN0000182698 GTTGGAATGCAAGAAGAGCGA pLKO.1 451 CDS 100% 0.660 0.396 N Msantd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09312 pDONR223 100% 86.5% 96% None (many diffs) n/a
2 ccsbBroad304_09312 pLX_304 0% 86.5% 96% V5 (many diffs) n/a
3 TRCN0000467618 ATGTCAATGGGCTATTTGCCCCGG pLX_317 25.5% 86.5% 96% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV