Transcript: Mouse XM_011250468.2

PREDICTED: Mus musculus zinc finger protein 583 (Zfp583), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp583 (213011)
Length:
6849
CDS:
143..1948

Additional Resources:

NCBI RefSeq record:
XM_011250468.2
NBCI Gene record:
Zfp583 (213011)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252373 CGCAAACCTAGCACAACATAA pLKO_005 994 CDS 100% 13.200 18.480 N Zfp583 n/a
2 TRCN0000252372 TCAATTGTTCATCACTCATAA pLKO_005 661 CDS 100% 13.200 18.480 N Zfp583 n/a
3 TRCN0000229553 AGCCTTGACTGTCCCGATTTG pLKO_005 575 CDS 100% 10.800 15.120 N Zfp583 n/a
4 TRCN0000252374 GCCGTCCATCAGAATGCAATA pLKO_005 728 CDS 100% 10.800 8.640 N Zfp583 n/a
5 TRCN0000229556 GCTTACCAATATCCAAGTTTG pLKO_005 2150 3UTR 100% 10.800 8.640 N Zfp583 n/a
6 TRCN0000252375 TGACCCATTGGAACCATTTAT pLKO_005 1963 3UTR 100% 15.000 10.500 N Zfp583 n/a
7 TRCN0000229555 GCCAAGAACTCTAGGCTTAAT pLKO_005 1921 CDS 100% 13.200 9.240 N Zfp583 n/a
8 TRCN0000229554 CATGAGAAAGTCCATACTATG pLKO_005 1850 CDS 100% 10.800 7.560 N Zfp583 n/a
9 TRCN0000218442 GCATTTAGTAACGGTTCATTC pLKO_005 1232 CDS 100% 10.800 7.560 N Zfp583 n/a
10 TRCN0000265342 TAGTTATAGTGGATCTCTTAC pLKO_005 1741 CDS 100% 10.800 7.560 N Zfp583 n/a
11 TRCN0000427014 ACCGGAGAGAAACCCTATGAG pLKO_005 1529 CDS 100% 4.950 2.475 Y Zfp647 n/a
12 TRCN0000235219 ACAGGAGAGAAACCCTATAAA pLKO_005 1613 CDS 100% 15.000 7.500 Y LOC66376 n/a
13 TRCN0000235327 ACAGGAGAGAAACCCTATAAA pLKO_005 1613 CDS 100% 15.000 7.500 Y OTTMUSG00000016228 n/a
14 TRCN0000086605 CCGGAGAGAAACCCTATGAAT pLKO.1 1530 CDS 100% 5.625 2.813 Y Zfp933 n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4126 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05006 pDONR223 100% 80% 77.5% None (many diffs) n/a
2 ccsbBroad304_05006 pLX_304 0% 80% 77.5% V5 (many diffs) n/a
Download CSV