Transcript: Mouse XM_011250536.2

PREDICTED: Mus musculus zinc finger protein 420 (Zfp420), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp420 (233058)
Length:
3298
CDS:
359..2095

Additional Resources:

NCBI RefSeq record:
XM_011250536.2
NBCI Gene record:
Zfp420 (233058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250536.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095152 AGAGGGTTCATACTAACGAAA pLKO.1 1173 CDS 100% 4.950 6.930 N Zfp420 n/a
2 TRCN0000095151 GAATGCCGAATAGACTTTAAT pLKO.1 2051 CDS 100% 15.000 10.500 N Zfp420 n/a
3 TRCN0000095149 GCTGTGATATAGAAGGTCTTT pLKO.1 2311 3UTR 100% 4.950 3.465 N Zfp420 n/a
4 TRCN0000095153 GAATTCATATCCGTGGCAAAT pLKO.1 2016 CDS 100% 0.000 0.000 N Zfp420 n/a
5 TRCN0000095150 GCACGTGGATTGTTGCTCATA pLKO.1 1649 CDS 100% 4.950 2.970 N Zfp420 n/a
6 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1773 CDS 100% 5.625 2.813 Y ZNF345 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250536.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05004 pDONR223 100% 71.5% 76.3% None (many diffs) n/a
2 ccsbBroad304_05004 pLX_304 0% 71.5% 76.3% V5 (many diffs) n/a
3 TRCN0000479330 AGCGGACCGAGCAAAGCTACTGGT pLX_317 23.2% 71.5% 76.3% V5 (many diffs) n/a
Download CSV