Transcript: Mouse XM_011250653.1

PREDICTED: Mus musculus SUMO1 activating enzyme subunit 1 (Sae1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sae1 (56459)
Length:
954
CDS:
142..954

Additional Resources:

NCBI RefSeq record:
XM_011250653.1
NBCI Gene record:
Sae1 (56459)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040499 CGAATCTTGGAGAGCATGAAT pLKO.1 653 CDS 100% 5.625 7.875 N Sae1 n/a
2 TRCN0000301191 CGAATCTTGGAGAGCATGAAT pLKO_005 653 CDS 100% 5.625 7.875 N Sae1 n/a
3 TRCN0000040501 GAGTCCTTCTTCACGAAGTTT pLKO.1 511 CDS 100% 5.625 3.938 N Sae1 n/a
4 TRCN0000301269 GAGTCCTTCTTCACGAAGTTT pLKO_005 511 CDS 100% 5.625 3.938 N Sae1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07540 pDONR223 100% 66.9% 66.8% None (many diffs) n/a
2 ccsbBroad304_07540 pLX_304 0% 66.9% 66.8% V5 (many diffs) n/a
3 TRCN0000468565 TTCCTGCAACTGCAATAATGCGTT pLX_317 39.2% 66.9% 66.8% V5 (many diffs) n/a
Download CSV