Transcript: Mouse XM_011250720.2

PREDICTED: Mus musculus zinc finger protein 74 (Zfp74), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp74 (72723)
Length:
4420
CDS:
800..2839

Additional Resources:

NCBI RefSeq record:
XM_011250720.2
NBCI Gene record:
Zfp74 (72723)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250720.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095443 CGGCACTGACAGTACACATTA pLKO.1 1962 CDS 100% 13.200 18.480 N Zfp74 n/a
2 TRCN0000095441 CCAATCTCATTGATCACGAAA pLKO.1 1626 CDS 100% 4.950 3.465 N Zfp74 n/a
3 TRCN0000095439 CCCAGATTTGTGGCTTGGTTT pLKO.1 4066 3UTR 100% 4.950 3.465 N Zfp74 n/a
4 TRCN0000095440 CCTTCCATGCACAGTCTCTTT pLKO.1 1172 CDS 100% 4.950 3.465 N Zfp74 n/a
5 TRCN0000095442 CTCTTCTCTTACGCTTCACAT pLKO.1 2716 CDS 100% 4.950 3.465 N Zfp74 n/a
6 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 1652 CDS 100% 6.000 3.000 Y Zfp612 n/a
7 TRCN0000240204 ATACGGGAGAGAAACCTTATG pLKO_005 2325 CDS 100% 10.800 5.400 Y EG665449 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3853 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250720.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15260 pDONR223 59.5% 64.2% 70.2% None (many diffs) n/a
2 ccsbBroad304_15260 pLX_304 0% 64.2% 70.2% V5 (many diffs) n/a
3 TRCN0000473293 AAATTACCAAATTATGGCATAGAT pLX_317 18.2% 36.1% 37.8% V5 (many diffs) n/a
Download CSV