Transcript: Mouse XM_011250820.2

PREDICTED: Mus musculus furin (paired basic amino acid cleaving enzyme) (Furin), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Furin (18550)
Length:
4567
CDS:
643..3054

Additional Resources:

NCBI RefSeq record:
XM_011250820.2
NBCI Gene record:
Furin (18550)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304644 CCGACCTAGCAGGCAATTATG pLKO_005 1124 CDS 100% 13.200 18.480 N Furin n/a
2 TRCN0000032888 GCCAGATCTTCGGTGACTATT pLKO.1 815 CDS 100% 13.200 18.480 N Furin n/a
3 TRCN0000302220 GCCAGATCTTCGGTGACTATT pLKO_005 815 CDS 100% 13.200 18.480 N Furin n/a
4 TRCN0000032884 CCTCGGTACACACAGATGAAT pLKO.1 1192 CDS 100% 5.625 7.875 N Furin n/a
5 TRCN0000032886 GTAGCTTACAATGCCCGAATT pLKO.1 1285 CDS 100% 0.000 0.000 N Furin n/a
6 TRCN0000304643 CCGAAGAAGCTGCAGTCTTAG pLKO_005 3506 3UTR 100% 10.800 7.560 N Furin n/a
7 TRCN0000349046 CCTTGGCAGCTGGTATCATTG pLKO_005 1787 CDS 100% 10.800 7.560 N Furin n/a
8 TRCN0000032885 CTGCCTTATCATCGTGCTCAT pLKO.1 2832 CDS 100% 4.050 2.835 N Furin n/a
9 TRCN0000032887 CTGACCAAGTTCACTCTCGTT pLKO.1 2359 CDS 100% 2.640 1.848 N Furin n/a
10 TRCN0000302146 CTGACCAAGTTCACTCTCGTT pLKO_005 2359 CDS 100% 2.640 1.848 N Furin n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06683 pDONR223 100% 87.3% 92.6% None (many diffs) n/a
2 ccsbBroad304_06683 pLX_304 22.8% 87.3% 92.6% V5 (many diffs) n/a
3 TRCN0000479603 GCTAGTAAGGGTCCACACTCGATG pLX_317 13.2% 87.3% 92.6% V5 (many diffs) n/a
Download CSV