Transcript: Mouse XM_011250831.2

PREDICTED: Mus musculus small nuclear ribonucleoprotein 70 (U1) (Snrnp70), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snrnp70 (20637)
Length:
1467
CDS:
242..919

Additional Resources:

NCBI RefSeq record:
XM_011250831.2
NBCI Gene record:
Snrnp70 (20637)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250831.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109161 GCACCATACATCCGAGAGTTT pLKO.1 365 CDS 100% 4.950 6.930 N Snrnp70 n/a
2 TRCN0000287201 GCACCATACATCCGAGAGTTT pLKO_005 365 CDS 100% 4.950 6.930 N Snrnp70 n/a
3 TRCN0000294705 ATCCACATGGTATACAGTAAA pLKO_005 635 CDS 100% 13.200 9.240 N Snrnp70 n/a
4 TRCN0000109162 CGATGCCTTCAAGACTCTGTT pLKO.1 538 CDS 100% 4.950 3.465 N Snrnp70 n/a
5 TRCN0000287138 CGATGCCTTCAAGACTCTGTT pLKO_005 538 CDS 100% 4.950 3.465 N Snrnp70 n/a
6 TRCN0000109164 GCCTTCATCGAGTATGAGCAT pLKO.1 680 CDS 100% 2.640 1.848 N Snrnp70 n/a
7 TRCN0000287200 GCCTTCATCGAGTATGAGCAT pLKO_005 680 CDS 100% 2.640 1.848 N Snrnp70 n/a
8 TRCN0000000015 GACATGCACTCCGCTTACAAA pLKO.1 707 CDS 100% 5.625 7.875 N SNRNP70 n/a
9 TRCN0000349622 GACATGCACTCCGCTTACAAA pLKO_005 707 CDS 100% 5.625 7.875 N SNRNP70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250831.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06982 pDONR223 100% 43.2% 45.2% None (many diffs) n/a
2 ccsbBroad304_06982 pLX_304 0% 43.2% 45.2% V5 (many diffs) n/a
3 TRCN0000480471 CTCGCGGACACAGTTATGTTCTCA pLX_317 27.3% 43.2% 45.2% V5 (many diffs) n/a
Download CSV