Transcript: Human XM_011509142.2

PREDICTED: Homo sapiens thioesterase superfamily member 4 (THEM4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THEM4 (117145)
Length:
1641
CDS:
278..808

Additional Resources:

NCBI RefSeq record:
XM_011509142.2
NBCI Gene record:
THEM4 (117145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422763 GTGCCATTGCAACCATGATTG pLKO_005 546 CDS 100% 10.800 15.120 N THEM4 n/a
2 TRCN0000048720 CTTCATATAAACGTACACCTA pLKO.1 315 CDS 100% 2.640 3.696 N THEM4 n/a
3 TRCN0000048719 GACTGCTCTTTGACCAGTTTA pLKO.1 258 5UTR 100% 13.200 9.240 N THEM4 n/a
4 TRCN0000435169 TAAATAGCCAACTTGATAAAG pLKO_005 672 CDS 100% 13.200 9.240 N THEM4 n/a
5 TRCN0000419869 TGATGTTCTACAATGACATTG pLKO_005 456 CDS 100% 10.800 7.560 N THEM4 n/a
6 TRCN0000048721 CTTCTGAGGAAGTCATTCTTA pLKO.1 195 5UTR 100% 5.625 3.938 N THEM4 n/a
7 TRCN0000048722 CCCTATACTCAGAGGCGACAA pLKO.1 747 CDS 100% 4.050 2.835 N THEM4 n/a
8 TRCN0000048718 CCCTCTTTGTTCTGTTGTTAT pLKO.1 649 CDS 100% 13.200 7.920 N THEM4 n/a
9 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1207 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09441 pDONR223 100% 73.1% 73.3% None 0_1ins192;18C>T n/a
2 ccsbBroad304_09441 pLX_304 0% 73.1% 73.3% V5 0_1ins192;18C>T n/a
3 TRCN0000477354 GTCCAAGCCGGCATAATTGCACTC pLX_317 63.9% 73.1% 73.3% V5 0_1ins192;18C>T n/a
Download CSV