Transcript: Human XM_011509351.3

PREDICTED: Homo sapiens flavin containing dimethylaniline monoxygenase 5 (FMO5), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FMO5 (2330)
Length:
2367
CDS:
316..1728

Additional Resources:

NCBI RefSeq record:
XM_011509351.3
NBCI Gene record:
FMO5 (2330)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064512 CAATGACAATAGGCAAGTTTA pLKO.1 1664 CDS 100% 13.200 18.480 N FMO5 n/a
2 TRCN0000064510 GCCAATCATTAGCAAACAAAT pLKO.1 872 CDS 100% 13.200 9.240 N FMO5 n/a
3 TRCN0000064511 CCTGGAATTGAGAAGTTCAAA pLKO.1 610 CDS 100% 5.625 3.938 N FMO5 n/a
4 TRCN0000064509 GCCCTCACAGAGTGAAATGAT pLKO.1 1323 CDS 100% 5.625 3.938 N FMO5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00583 pDONR223 100% 41% 40.2% None (many diffs) n/a
2 ccsbBroad304_00583 pLX_304 0% 41% 40.2% V5 (many diffs) n/a
3 TRCN0000478916 TAAATCAAGTTTAACTCAACAAAC pLX_317 43.4% 41% 40.2% V5 (many diffs) n/a
Download CSV