Transcript: Human XM_011509548.1

PREDICTED: Homo sapiens lymphocyte antigen 9 (LY9), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LY9 (4063)
Length:
2585
CDS:
34..2145

Additional Resources:

NCBI RefSeq record:
XM_011509548.1
NBCI Gene record:
LY9 (4063)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230028 CAACGGCAGATCCACTCATTA pLKO_005 1064 CDS 100% 13.200 18.480 N LY9 n/a
2 TRCN0000218513 ATGCACAAGTGTTCAACTTAC pLKO_005 1982 CDS 100% 10.800 15.120 N LY9 n/a
3 TRCN0000230029 TAGCGTTTCCTCCTCGAAATT pLKO_005 2399 3UTR 100% 13.200 10.560 N LY9 n/a
4 TRCN0000230027 TGTTTAACACATCCATCATTA pLKO_005 1022 CDS 100% 13.200 9.240 N LY9 n/a
5 TRCN0000230026 ATGATGCAGGATCCTACAAAG pLKO_005 545 CDS 100% 10.800 7.560 N LY9 n/a
6 TRCN0000152741 GAGAAGGTTGTCTGGTTGTTT pLKO.1 1006 CDS 100% 5.625 3.938 N LY9 n/a
7 TRCN0000156788 GCCACAATCTACTGCTCCATA pLKO.1 2041 CDS 100% 4.950 3.465 N LY9 n/a
8 TRCN0000153301 GCCCAGATAAACCAAAGGAAT pLKO.1 565 CDS 100% 4.950 3.465 N LY9 n/a
9 TRCN0000157350 CTGGTGCATTTGGAAGCGAAA pLKO.1 1590 CDS 100% 4.050 2.835 N LY9 n/a
10 TRCN0000151090 GCTGCAAATATTCTCTTCTGT pLKO.1 80 CDS 100% 3.000 2.100 N LY9 n/a
11 TRCN0000157021 GCATCAGCAATCTGACTCTGA pLKO.1 524 CDS 100% 2.640 1.848 N LY9 n/a
12 TRCN0000157098 GTCATCTGGATTGGTCCCAAA pLKO.1 406 CDS 100% 4.050 2.430 N LY9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10954 pDONR223 100% 57.4% 57.3% None (many diffs) n/a
2 ccsbBroad304_10954 pLX_304 0% 57.4% 57.3% V5 (many diffs) n/a
3 TRCN0000471835 AACACCGTATATATTATCATCCCT pLX_317 33.2% 57.4% 57.3% V5 (many diffs) n/a
4 ccsbBroadEn_00953 pDONR223 100% 24.1% 19.8% None (many diffs) n/a
5 ccsbBroad304_00953 pLX_304 0% 24.1% 19.8% V5 (many diffs) n/a
6 TRCN0000471218 ACTTGCAAGGCCAGATGATACTCG pLX_317 77.2% 24.1% 19.8% V5 (many diffs) n/a
Download CSV