Transcript: Human XM_011509718.3

PREDICTED: Homo sapiens proton activated chloride channel 1 (PACC1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PACC1 (55248)
Length:
2108
CDS:
205..1209

Additional Resources:

NCBI RefSeq record:
XM_011509718.3
NBCI Gene record:
PACC1 (55248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509718.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285381 GAAGTCACCTCGCGTTGTTTA pLKO_005 1366 3UTR 100% 13.200 18.480 N PACC1 n/a
2 TRCN0000136154 GAACAAGAGTAGTGAGGACTT pLKO.1 1026 CDS 100% 4.050 5.670 N PACC1 n/a
3 TRCN0000275465 GAACAAGAGTAGTGAGGACTT pLKO_005 1026 CDS 100% 4.050 5.670 N PACC1 n/a
4 TRCN0000275464 GTTTGCCAAACTGAGTATAAA pLKO_005 1280 3UTR 100% 15.000 10.500 N PACC1 n/a
5 TRCN0000135806 CCACTTTGTAAACGGAGCTAT pLKO.1 1423 3UTR 100% 4.950 3.465 N PACC1 n/a
6 TRCN0000285384 CCACTTTGTAAACGGAGCTAT pLKO_005 1423 3UTR 100% 4.950 3.465 N PACC1 n/a
7 TRCN0000138897 GAAACTCAAGCACCCTGTCAT pLKO.1 741 CDS 100% 4.950 3.465 N PACC1 n/a
8 TRCN0000285389 GAAACTCAAGCACCCTGTCAT pLKO_005 741 CDS 100% 4.950 3.465 N PACC1 n/a
9 TRCN0000135119 CCAAGATATAGTCACTGCCAA pLKO.1 1199 CDS 100% 2.640 1.848 N PACC1 n/a
10 TRCN0000138238 CCTGAACAAGAGTAGTGAGGA pLKO.1 1023 CDS 100% 2.640 1.848 N PACC1 n/a
11 TRCN0000135459 GTGTCTTACAAGGAAGTGGAT pLKO.1 766 CDS 100% 2.640 1.848 N PACC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509718.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03561 pDONR223 100% 56.5% 45.7% None (many diffs) n/a
2 ccsbBroad304_03561 pLX_304 0% 56.5% 45.7% V5 (many diffs) n/a
3 TRCN0000467460 CCCAGTGGGGTCCGGGTCAACTCG pLX_317 41.7% 56.5% 45.7% V5 (many diffs) n/a
Download CSV