Transcript: Human XM_011509739.2

PREDICTED: Homo sapiens hedgehog acyltransferase (HHAT), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HHAT (55733)
Length:
3809
CDS:
229..1785

Additional Resources:

NCBI RefSeq record:
XM_011509739.2
NBCI Gene record:
HHAT (55733)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422901 TTGATGTTGGACTGCATAATT pLKO_005 1241 CDS 100% 15.000 21.000 N HHAT n/a
2 TRCN0000422181 CACTTTATTTGGAGGATTAAA pLKO_005 363 CDS 100% 15.000 12.000 N HHAT n/a
3 TRCN0000422431 ACTGGATGCTGGATCTCATAG pLKO_005 2022 3UTR 100% 10.800 7.560 N HHAT n/a
4 TRCN0000035599 CCCTGGATTCTCATGCTCTAT pLKO.1 508 CDS 100% 4.950 3.465 N HHAT n/a
5 TRCN0000035601 CGTGAGCACCATGTTCAGTTT pLKO.1 1200 CDS 100% 4.950 3.465 N HHAT n/a
6 TRCN0000035600 GCCACATGGTAGTGTCTCAAA pLKO.1 458 CDS 100% 4.950 3.465 N HHAT n/a
7 TRCN0000035602 GCTCCATACCACCATCTCTTT pLKO.1 582 CDS 100% 4.950 3.465 N HHAT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08572 pDONR223 100% 92% 88% None (many diffs) n/a
2 ccsbBroad304_08572 pLX_304 0% 92% 88% V5 (many diffs) n/a
3 TRCN0000475311 ACGTCTAAACTGCGCTGTATTCCT pLX_317 22.3% 92% 88% V5 (many diffs) n/a
Download CSV