Transcript: Human XM_011509898.2

PREDICTED: Homo sapiens SHC adaptor protein 1 (SHC1), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHC1 (6464)
Length:
1627
CDS:
249..1547

Additional Resources:

NCBI RefSeq record:
XM_011509898.2
NBCI Gene record:
SHC1 (6464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509898.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040211 CCTGACCATCAGTACTATAAT pLKO.1 783 CDS 100% 15.000 10.500 N SHC1 n/a
2 TRCN0000040209 CCACATGCAATCTATCTCATT pLKO.1 515 CDS 100% 4.950 3.465 N SHC1 n/a
3 TRCN0000088012 GTTGCCAAAGACCCTGTGAAT pLKO.1 579 CDS 100% 4.950 3.465 N Gm5500 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509898.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01531 pDONR223 100% 80.3% 75.7% None (many diffs) n/a
2 ccsbBroad304_01531 pLX_304 0% 80.3% 75.7% V5 (many diffs) n/a
3 TRCN0000465390 ATCGGCAAGCCATCCCTGGATCAC pLX_317 28.1% 80.3% 75.7% V5 (many diffs) n/a
4 TRCN0000491918 GCGGCCTCTAACTACATTGATACC pLX_317 21% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV