Transcript: Human XM_011509944.2

PREDICTED: Homo sapiens troponin T2, cardiac type (TNNT2), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNNT2 (7139)
Length:
1184
CDS:
140..988

Additional Resources:

NCBI RefSeq record:
XM_011509944.2
NBCI Gene record:
TNNT2 (7139)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509944.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083643 CGATAACCAGAAAGTCTCCAA pLKO.1 928 CDS 100% 2.640 3.696 N TNNT2 n/a
2 TRCN0000426463 GAGATCAATGTTCTCCGAAAC pLKO_005 899 CDS 100% 6.000 4.800 N TNNT2 n/a
3 TRCN0000416744 ACCAAAGCCCAGGTCGTTCAT pLKO_005 313 CDS 100% 4.950 3.465 N TNNT2 n/a
4 TRCN0000083647 CGATGGAGAGAGAGTGGACTT pLKO.1 361 CDS 100% 4.050 2.835 N TNNT2 n/a
5 TRCN0000421488 GACCACCTGAATGAAGATCAG pLKO_005 785 CDS 100% 4.050 2.835 N TNNT2 n/a
6 TRCN0000415600 TCAAAGACAGGATCGAGAGAC pLKO_005 489 CDS 100% 4.050 2.835 N TNNT2 n/a
7 TRCN0000083646 GCAGAGCATCTATAACTTGGA pLKO.1 832 CDS 100% 2.640 1.848 N TNNT2 n/a
8 TRCN0000083645 GAAGGCTTTGTCCAACATGAT pLKO.1 646 CDS 100% 4.950 2.970 N TNNT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509944.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01693 pDONR223 100% 96.8% 96.8% None 48_49insGAAGAAGCAGCTGTT;113_114insAGA;551_559delAGCAGGCCC n/a
2 ccsbBroad304_01693 pLX_304 0% 96.8% 96.8% V5 48_49insGAAGAAGCAGCTGTT;113_114insAGA;551_559delAGCAGGCCC n/a
3 TRCN0000492217 GTGCTGCGACTTACACACAATCTC pLX_317 47.3% 96.7% 96.8% V5 (many diffs) n/a
Download CSV