Transcript: Human XM_011509976.2

PREDICTED: Homo sapiens Fc receptor like 2 (FCRL2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FCRL2 (79368)
Length:
2859
CDS:
396..1856

Additional Resources:

NCBI RefSeq record:
XM_011509976.2
NBCI Gene record:
FCRL2 (79368)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052837 GCTTACCATAAGGATAACAAA pLKO.1 543 CDS 100% 5.625 7.875 N FCRL2 n/a
2 TRCN0000359450 GGACTTGATAGTGGTGTATTA pLKO_005 2190 3UTR 100% 13.200 9.240 N FCRL2 n/a
3 TRCN0000359451 TAAGTGACAGTGGTAACTATT pLKO_005 616 CDS 100% 13.200 9.240 N FCRL2 n/a
4 TRCN0000052833 CCACAGAGGTTGGATGTTCAA pLKO.1 795 CDS 100% 4.950 3.465 N FCRL2 n/a
5 TRCN0000052835 GACAACTCTTTCTCTGGGATA pLKO.1 652 CDS 100% 4.050 2.835 N FCRL2 n/a
6 TRCN0000052836 CCAGAGCAAGGTGGTGAATAT pLKO.1 1247 CDS 100% 13.200 7.920 N FCRL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12563 pDONR223 100% 42.9% 37.4% None (many diffs) n/a
2 ccsbBroad304_12563 pLX_304 0% 42.9% 37.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477302 AGAAGGGGACCTTGATTCCCGAAA pLX_317 44.2% 42.9% 37.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_12562 pDONR223 100% 41.5% 41.5% None 309_1160del n/a
5 ccsbBroad304_12562 pLX_304 0% 41.5% 41.5% V5 309_1160del n/a
6 TRCN0000481383 CCAGGGCACGGACCACCTTAATGA pLX_317 65.4% 41.5% 41.5% V5 309_1160del n/a
Download CSV