Transcript: Human XM_011510026.2

PREDICTED: Homo sapiens sorting nexin 27 (SNX27), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNX27 (81609)
Length:
1484
CDS:
113..1372

Additional Resources:

NCBI RefSeq record:
XM_011510026.2
NBCI Gene record:
SNX27 (81609)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510026.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245091 AGTACTACAGACCAAGTATAT pLKO_005 995 CDS 100% 13.200 18.480 N SNX27 n/a
2 TRCN0000245092 TACGTAAATTGGCACCTAATG pLKO_005 1098 CDS 100% 10.800 15.120 N SNX27 n/a
3 TRCN0000005726 CAACGGTTACAGTCAGGGTTA pLKO.1 966 CDS 100% 4.050 5.670 N SNX27 n/a
4 TRCN0000005724 GTGTGTTCAATACGAGTAATT pLKO.1 848 CDS 100% 13.200 10.560 N SNX27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510026.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12725 pDONR223 100% 17.8% 15.7% None (many diffs) n/a
2 ccsbBroad304_12725 pLX_304 0% 17.8% 15.7% V5 (many diffs) n/a
3 TRCN0000478297 CCAGACCGGAACGTTATTTTCAGG pLX_317 46.2% 17.8% 15.7% V5 (many diffs) n/a
Download CSV