Transcript: Human XM_011510538.2

PREDICTED: Homo sapiens polypeptide N-acetylgalactosaminyltransferase 13 (GALNT13), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GALNT13 (114805)
Length:
5484
CDS:
533..1705

Additional Resources:

NCBI RefSeq record:
XM_011510538.2
NBCI Gene record:
GALNT13 (114805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435109 ACTCATGTCATAGGGTTAATT pLKO_005 2140 3UTR 100% 15.000 21.000 N GALNT13 n/a
2 TRCN0000425841 GAAGAACGCTCTGGGTTAATA pLKO_005 536 CDS 100% 15.000 21.000 N GALNT13 n/a
3 TRCN0000414831 ACTCACGTTGCGACATGTTAA pLKO_005 1720 3UTR 100% 13.200 18.480 N GALNT13 n/a
4 TRCN0000417381 TTACGATGCAGGAATGGATAT pLKO_005 910 CDS 100% 10.800 15.120 N GALNT13 n/a
5 TRCN0000035396 GCCAGTGATTTGATTGCCCTT pLKO.1 113 5UTR 100% 2.160 3.024 N GALNT13 n/a
6 TRCN0000035394 GCCCTATCATTGATGTGATTA pLKO.1 690 CDS 100% 13.200 10.560 N GALNT13 n/a
7 TRCN0000433073 ATGGACCTGTAATCATGTTAA pLKO_005 1452 CDS 100% 13.200 9.240 N GALNT13 n/a
8 TRCN0000430005 TCTACAACAGGGCCACATATT pLKO_005 2306 3UTR 100% 13.200 9.240 N GALNT13 n/a
9 TRCN0000434062 TGGTGATTGAAAGAGATAATG pLKO_005 2187 3UTR 100% 13.200 9.240 N GALNT13 n/a
10 TRCN0000035395 GCTGTGTTGATTCCTAAAGAT pLKO.1 41 5UTR 100% 5.625 3.938 N GALNT13 n/a
11 TRCN0000035398 CCAGGTGTTGTCAAAGTGGAT pLKO.1 1142 CDS 100% 2.640 1.848 N GALNT13 n/a
12 TRCN0000035397 GCTGCTAAGGAACATGACCTT pLKO.1 1828 3UTR 100% 2.640 1.848 N GALNT13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13039 pDONR223 100% 66.5% 66.5% None 0_1ins543;986_1015del n/a
2 ccsbBroad304_13039 pLX_304 0% 66.5% 66.5% V5 0_1ins543;986_1015del n/a
Download CSV