Transcript: Human XM_011510598.3

PREDICTED: Homo sapiens raftlin family member 2 (RFTN2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RFTN2 (130132)
Length:
5605
CDS:
337..1821

Additional Resources:

NCBI RefSeq record:
XM_011510598.3
NBCI Gene record:
RFTN2 (130132)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510598.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417018 AGATGTTCCATTCGGTTATTA pLKO_005 2057 3UTR 100% 15.000 21.000 N RFTN2 n/a
2 TRCN0000135640 GTTGGAATGAAGGGACGTTAA pLKO.1 872 CDS 100% 10.800 15.120 N RFTN2 n/a
3 TRCN0000135385 GCGCTTGAAATTAAGCCCAAA pLKO.1 645 CDS 100% 4.050 5.670 N RFTN2 n/a
4 TRCN0000138930 GAGTGACTCAGGTCACTTGTA pLKO.1 1796 CDS 100% 0.495 0.693 N RFTN2 n/a
5 TRCN0000434835 GGCTACAAAGCAGATCGTATT pLKO_005 1452 CDS 100% 10.800 8.640 N RFTN2 n/a
6 TRCN0000439987 ACAACGTCCTCCGGGAATTAG pLKO_005 1748 CDS 100% 13.200 9.240 N RFTN2 n/a
7 TRCN0000435745 ACAGAATTTGCTTACGAATAT pLKO_005 430 CDS 100% 13.200 9.240 N RFTN2 n/a
8 TRCN0000425296 CTGAATATCTCAATCAGTATT pLKO_005 2146 3UTR 100% 13.200 9.240 N RFTN2 n/a
9 TRCN0000137738 GAGACCGCAAGTGGAAACAAA pLKO.1 408 CDS 100% 5.625 3.938 N RFTN2 n/a
10 TRCN0000135247 CCTTCTAATAGAGGTGGCTTT pLKO.1 2804 3UTR 100% 4.050 2.835 N RFTN2 n/a
11 TRCN0000138726 GCAGTCATCTGAAAGCGGAAT pLKO.1 897 CDS 100% 4.050 2.835 N RFTN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510598.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04859 pDONR223 100% 94.7% 94.7% None 436_437ins51;1183_1212del n/a
2 ccsbBroad304_04859 pLX_304 0% 94.7% 94.7% V5 436_437ins51;1183_1212del n/a
3 TRCN0000480918 CAACACGCTGGGCACGGTCGGCCA pLX_317 28.5% 94.7% 94.7% V5 436_437ins51;1183_1212del n/a
Download CSV