Transcript: Human XM_011510794.2

PREDICTED: Homo sapiens ERCC excision repair 3, TFIIH core complex helicase subunit (ERCC3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERCC3 (2071)
Length:
2758
CDS:
86..2452

Additional Resources:

NCBI RefSeq record:
XM_011510794.2
NBCI Gene record:
ERCC3 (2071)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510794.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359265 CGACTGAACAAACCCTATATC pLKO_005 1823 CDS 100% 13.200 18.480 N ERCC3 n/a
2 TRCN0000359267 GATCCGAGAATGCCGCTTAAG pLKO_005 664 CDS 100% 10.800 15.120 N ERCC3 n/a
3 TRCN0000359264 TCTTGGTAGATCAAGGTTATA pLKO_005 2139 CDS 100% 13.200 10.560 N ERCC3 n/a
4 TRCN0000359266 ACCCGCTCTTCAAGCGCTTTA pLKO_005 2424 CDS 100% 10.800 7.560 N ERCC3 n/a
5 TRCN0000022083 CGGGAATATGTGGCAATCAAA pLKO.1 1661 CDS 100% 5.625 3.938 N ERCC3 n/a
6 TRCN0000022080 CCGGAAGCAAATGTCCTCATT pLKO.1 1955 CDS 100% 4.950 3.465 N ERCC3 n/a
7 TRCN0000022081 GCCCTAAAGGAATATGCCATT pLKO.1 1802 CDS 100% 4.050 2.835 N ERCC3 n/a
8 TRCN0000022082 CCAGTTTACAAATATGCCCAA pLKO.1 356 CDS 100% 2.160 1.512 N ERCC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510794.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00513 pDONR223 100% 99.2% 99.2% None 658_675del n/a
2 ccsbBroad304_00513 pLX_304 0% 99.2% 99.2% V5 658_675del n/a
Download CSV