Transcript: Human XM_011510796.3

PREDICTED: Homo sapiens fibroblast activation protein alpha (FAP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAP (2191)
Length:
2865
CDS:
318..2570

Additional Resources:

NCBI RefSeq record:
XM_011510796.3
NBCI Gene record:
FAP (2191)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355738 ATCCCGTTGTTCGGATATTTA pLKO_005 1063 CDS 100% 15.000 21.000 N FAP n/a
2 TRCN0000006802 CCCTCAGACAGTTTGCTTATT pLKO.1 2621 3UTR 100% 13.200 18.480 N FAP n/a
3 TRCN0000355736 GATACGGATATACCAGTTATT pLKO_005 969 CDS 100% 13.200 18.480 N FAP n/a
4 TRCN0000006806 GCGATGAACAATATCCTAGAA pLKO.1 1006 CDS 100% 4.950 6.930 N FAP n/a
5 TRCN0000006803 CGGAATTTAATGATACGGATA pLKO.1 958 CDS 100% 4.050 3.240 N FAP n/a
6 TRCN0000355737 TGATAATCTTGAGCACTATAA pLKO_005 2300 CDS 100% 13.200 9.240 N FAP n/a
7 TRCN0000006804 CCCTTGCTAATTCAAGTGTAT pLKO.1 1890 CDS 100% 4.950 3.465 N FAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491844 GTTATGGCCCGAAGTTCCCCCTTC pLX_317 9.2% 97.4% 96.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489227 CAGGGGTGGAGGGGATATCAACAT pLX_317 16.7% 97.4% 96.3% V5 (many diffs) n/a
Download CSV