Transcript: Human XM_011510869.1

PREDICTED: Homo sapiens transmembrane protein 131 (TMEM131), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM131 (23505)
Length:
6544
CDS:
265..5781

Additional Resources:

NCBI RefSeq record:
XM_011510869.1
NBCI Gene record:
TMEM131 (23505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246000 ATTATGCGCCAAGATCTAATT pLKO_005 6213 3UTR 100% 13.200 18.480 N TMEM131 n/a
2 TRCN0000246003 CATAGATTGAGTGCTATATTT pLKO_005 2713 CDS 100% 15.000 10.500 N TMEM131 n/a
3 TRCN0000257459 TAGCAGTTTCTCACCTATAAT pLKO_005 984 CDS 100% 15.000 10.500 N TMEM131 n/a
4 TRCN0000246001 TCCAATTGAGTTGGCTATAAA pLKO_005 2034 CDS 100% 15.000 10.500 N TMEM131 n/a
5 TRCN0000217090 CAGGAGAATCGTTGGTATTTC pLKO.1 3642 CDS 100% 13.200 9.240 N Tmem131 n/a
6 TRCN0000246002 CTCGGACCCTTGGTCTAATTC pLKO_005 5739 CDS 100% 13.200 9.240 N TMEM131 n/a
7 TRCN0000193221 CCTCAACTGAAATGTTAGATT pLKO.1 1286 CDS 100% 5.625 3.938 N Tmem131 n/a
8 TRCN0000435474 GTGGATCCAAATCACGAAATC pLKO_005 4667 CDS 100% 10.800 7.560 N Tmem131 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11742 pDONR223 100% 13.9% 13.9% None (many diffs) n/a
2 ccsbBroad304_11742 pLX_304 0% 13.9% 13.9% V5 (many diffs) n/a
3 TRCN0000477619 CTTGATCTACTGTATACCAACAAC pLX_317 50.4% 13.9% 13.9% V5 (many diffs) n/a
Download CSV