Transcript: Human XM_011510893.1

PREDICTED: Homo sapiens SH3 domain binding protein 4 (SH3BP4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SH3BP4 (23677)
Length:
5051
CDS:
328..3219

Additional Resources:

NCBI RefSeq record:
XM_011510893.1
NBCI Gene record:
SH3BP4 (23677)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510893.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127812 GAGTTTCTTCACCGGCTTGAA pLKO.1 1116 CDS 100% 4.950 6.930 N SH3BP4 n/a
2 TRCN0000292184 GAGTTTCTTCACCGGCTTGAA pLKO_005 1116 CDS 100% 4.950 6.930 N SH3BP4 n/a
3 TRCN0000130594 CCACACCTTTCGGAAATGCAA pLKO.1 479 CDS 100% 3.000 4.200 N SH3BP4 n/a
4 TRCN0000292185 CCACACCTTTCGGAAATGCAA pLKO_005 479 CDS 100% 3.000 4.200 N SH3BP4 n/a
5 TRCN0000381961 CTTTCACTCCCTGCGTGTAAG pLKO_005 3717 3UTR 100% 10.800 8.640 N SH3BP4 n/a
6 TRCN0000379832 ATGAGAAAGGTGGTATCTAAT pLKO_005 3500 3UTR 100% 13.200 9.240 N SH3BP4 n/a
7 TRCN0000146508 CGTGTGGGACTTCATCAATAA pLKO.1 1722 CDS 100% 13.200 9.240 N SH3BP4 n/a
8 TRCN0000146356 CACACCTTTCGGAAATGCAAA pLKO.1 480 CDS 100% 4.950 3.465 N SH3BP4 n/a
9 TRCN0000130786 GTCAGACTCATCCAGGACTTT pLKO.1 2839 CDS 100% 4.950 3.465 N SH3BP4 n/a
10 TRCN0000292183 GTCAGACTCATCCAGGACTTT pLKO_005 2839 CDS 100% 4.950 3.465 N SH3BP4 n/a
11 TRCN0000130838 GATGAAAGTGTCAGCCGAGAT pLKO.1 1509 CDS 100% 4.050 2.835 N SH3BP4 n/a
12 TRCN0000292186 GATGAAAGTGTCAGCCGAGAT pLKO_005 1509 CDS 100% 4.050 2.835 N SH3BP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510893.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02830 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02830 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_15021 pDONR223 0% 100% 100% None n/a
4 ccsbBroad304_15021 pLX_304 0% 100% 100% V5 n/a
5 TRCN0000468043 CATACAATATCCGGCGAACTCTTT pLX_317 13.3% 100% 100% V5 n/a
Download CSV