Transcript: Human XM_011510923.3

PREDICTED: Homo sapiens neuronal guanine nucleotide exchange factor (NGEF), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NGEF (25791)
Length:
3151
CDS:
216..2348

Additional Resources:

NCBI RefSeq record:
XM_011510923.3
NBCI Gene record:
NGEF (25791)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510923.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431839 TTGCTCGCAAACTGGATAAAG pLKO_005 2521 3UTR 100% 13.200 18.480 N NGEF n/a
2 TRCN0000047656 CGAGATAAATCGACTCTCCAA pLKO.1 762 CDS 100% 2.640 3.696 N NGEF n/a
3 TRCN0000419681 GAAGCTCTTCCACGAAATTTA pLKO_005 1748 CDS 100% 15.000 10.500 N NGEF n/a
4 TRCN0000419699 ATCAATGGAACACTGATAATG pLKO_005 271 CDS 100% 13.200 9.240 N NGEF n/a
5 TRCN0000047657 AGGAGACAAGTACCAGGTATT pLKO.1 1814 CDS 100% 10.800 7.560 N NGEF n/a
6 TRCN0000176123 GAACAAATAGGGCTCCTGTAT pLKO.1 732 CDS 100% 4.950 3.465 N Ngef n/a
7 TRCN0000047654 CCCAATTAAGAGAAATTCCAT pLKO.1 386 CDS 100% 3.000 2.100 N NGEF n/a
8 TRCN0000047653 CCATCTTCAATCGCTCCATAA pLKO.1 403 CDS 100% 10.800 6.480 N NGEF n/a
9 TRCN0000047655 CCAGAACCTCAAGGAATGTTT pLKO.1 2249 CDS 100% 5.625 3.375 N NGEF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510923.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07940 pDONR223 100% 99.8% 99.8% None (many diffs) n/a
2 ccsbBroad304_07940 pLX_304 0% 99.8% 99.8% V5 (many diffs) n/a
3 TRCN0000473691 GGTTTAACTTACTTCCATGAGTGG pLX_317 18.9% 99.8% 99.8% V5 (many diffs) n/a
Download CSV