Transcript: Human XM_011510924.1

PREDICTED: Homo sapiens neuronal guanine nucleotide exchange factor (NGEF), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NGEF (25791)
Length:
2183
CDS:
79..1380

Additional Resources:

NCBI RefSeq record:
XM_011510924.1
NBCI Gene record:
NGEF (25791)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431839 TTGCTCGCAAACTGGATAAAG pLKO_005 1553 3UTR 100% 13.200 18.480 N NGEF n/a
2 TRCN0000419681 GAAGCTCTTCCACGAAATTTA pLKO_005 780 CDS 100% 15.000 10.500 N NGEF n/a
3 TRCN0000047657 AGGAGACAAGTACCAGGTATT pLKO.1 846 CDS 100% 10.800 7.560 N NGEF n/a
4 TRCN0000047655 CCAGAACCTCAAGGAATGTTT pLKO.1 1281 CDS 100% 5.625 3.375 N NGEF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07940 pDONR223 100% 60.8% 60.9% None 0_1ins831;222T>C;240C>T n/a
2 ccsbBroad304_07940 pLX_304 0% 60.8% 60.9% V5 0_1ins831;222T>C;240C>T n/a
3 TRCN0000473691 GGTTTAACTTACTTCCATGAGTGG pLX_317 18.9% 60.8% 60.9% V5 0_1ins831;222T>C;240C>T n/a
Download CSV