Transcript: Human XM_011511348.3

PREDICTED: Homo sapiens FKBP prolyl isomerase 7 (FKBP7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FKBP7 (51661)
Length:
2717
CDS:
264..611

Additional Resources:

NCBI RefSeq record:
XM_011511348.3
NBCI Gene record:
FKBP7 (51661)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511348.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054000 GCTCTCTAAAGCCGAGATAAA pLKO.1 434 CDS 100% 13.200 18.480 N FKBP7 n/a
2 TRCN0000054002 CCACCGGATGCTACATTGATT pLKO.1 330 CDS 100% 5.625 7.875 N FKBP7 n/a
3 TRCN0000054001 CCACGGAGCATTGAGACATTT pLKO.1 384 CDS 100% 13.200 10.560 N FKBP7 n/a
4 TRCN0000053999 GCTTCATTTCTCCCAAGGAAT pLKO.1 562 CDS 100% 4.950 3.465 N FKBP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511348.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03359 pDONR223 100% 51.8% 44% None 0_1ins169;51_52ins152 n/a
2 ccsbBroad304_03359 pLX_304 0% 51.8% 44% V5 0_1ins169;51_52ins152 n/a
3 TRCN0000474688 CACACAATAATACTTGCGAGTAAT pLX_317 25.5% 51.8% 44% V5 0_1ins169;51_52ins152 n/a
Download CSV