Transcript: Human XM_011511500.1

PREDICTED: Homo sapiens mitochondrial fission factor (MFF), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MFF (56947)
Length:
2066
CDS:
322..1350

Additional Resources:

NCBI RefSeq record:
XM_011511500.1
NBCI Gene record:
MFF (56947)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511500.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167739 GCTAGTGTGATAATGCAAGTT pLKO.1 538 CDS 100% 4.950 6.930 N MFF n/a
2 TRCN0000167581 GCATCGACACTTCAACATTAA pLKO.1 1783 3UTR 100% 13.200 9.240 N MFF n/a
3 TRCN0000343573 TCAGTACGAAATGGAATATAC pLKO_005 420 CDS 100% 13.200 9.240 N MFF n/a
4 TRCN0000329032 ACAACGTCAGGTATGGCATTT pLKO_005 1124 CDS 100% 10.800 7.560 N Mff n/a
5 TRCN0000168097 CGTCAGGTATGGCATTTCAAA pLKO.1 1128 CDS 100% 5.625 3.938 N MFF n/a
6 TRCN0000168683 GCCACTTCTAATCCTCATCAT pLKO.1 1102 CDS 100% 4.950 3.465 N MFF n/a
7 TRCN0000343572 CCAAATGCTAGTGTGATAATG pLKO_005 532 CDS 100% 13.200 7.920 N MFF n/a
8 TRCN0000343574 GAAACTCGAACCACCTAATAT pLKO_005 1838 3UTR 100% 15.000 7.500 Y MFF n/a
9 TRCN0000343525 TAGCTTTCTGGCTGCTTAATA pLKO_005 1307 CDS 100% 15.000 7.500 Y MFF n/a
10 TRCN0000343523 GAGAACAAAGAACGTGCTAAA pLKO_005 1258 CDS 100% 10.800 5.400 Y MFF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511500.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12318 pDONR223 100% 69.5% 69.5% None 1_78del;519_752del n/a
2 ccsbBroad304_12318 pLX_304 0% 69.5% 69.5% V5 1_78del;519_752del n/a
3 TRCN0000476502 ACCCCCATCCAACTTCCGGATCTA pLX_317 50.8% 69.5% 69.5% V5 1_78del;519_752del n/a
Download CSV