Transcript: Human XM_011512072.2

PREDICTED: Homo sapiens Kruppel like factor 7 (KLF7), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLF7 (8609)
Length:
7436
CDS:
413..1324

Additional Resources:

NCBI RefSeq record:
XM_011512072.2
NBCI Gene record:
KLF7 (8609)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512072.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084230 CTCAACGCAGTGACCTCATTA pLKO.1 800 CDS 100% 13.200 18.480 N Klf7 n/a
2 TRCN0000013261 GTGCCGGAAAGTTTATACAAA pLKO.1 1087 CDS 100% 5.625 7.875 N KLF7 n/a
3 TRCN0000013262 CTTGAATTGGAACGCTACCTA pLKO.1 521 CDS 100% 3.000 2.400 N KLF7 n/a
4 TRCN0000084231 ACAGGAAACACACAGGTGCAA pLKO.1 1224 CDS 100% 2.640 2.112 N Klf7 n/a
5 TRCN0000257275 ACGGGTGCCGGAAAGTTTATA pLKO_005 1083 CDS 100% 15.000 10.500 N KLF7 n/a
6 TRCN0000235754 ACTGTCATGCACTCAACTATA pLKO_005 1509 3UTR 100% 13.200 9.240 N KLF7 n/a
7 TRCN0000235753 CCTCCACATGAAGAGACATAT pLKO_005 1300 CDS 100% 13.200 9.240 N KLF7 n/a
8 TRCN0000232328 TAACGGGTGCCGGAAAGTTTA pLKO_005 1081 CDS 100% 13.200 9.240 N Klf7 n/a
9 TRCN0000232325 TCAACGCAGTGACCTCATTAA pLKO_005 801 CDS 100% 13.200 9.240 N Klf7 n/a
10 TRCN0000235752 TCAACGCAGTGACCTCATTAA pLKO_005 801 CDS 100% 13.200 9.240 N KLF7 n/a
11 TRCN0000235751 ATGGCACGGTGACGTTGAAAC pLKO_005 888 CDS 100% 10.800 7.560 N KLF7 n/a
12 TRCN0000013259 CCACATGAAGAGACATATCTA pLKO.1 1303 CDS 100% 5.625 3.938 N KLF7 n/a
13 TRCN0000013260 GCTACTTCTCAGCTTTACCAT pLKO.1 471 CDS 100% 3.000 2.100 N KLF7 n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1454 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512072.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11283 pDONR223 100% 75.9% 57.9% None 532_736del;896_909del n/a
2 ccsbBroad304_11283 pLX_304 0% 75.9% 57.9% V5 532_736del;896_909del n/a
3 TRCN0000469755 CCACTTGTTCCCCGACCCCATAAG pLX_317 52.5% 75.9% 57.9% V5 532_736del;896_909del n/a
Download CSV