Transcript: Human XM_011512514.2

PREDICTED: Homo sapiens epithelial cell transforming 2 (ECT2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ECT2 (1894)
Length:
4757
CDS:
509..3385

Additional Resources:

NCBI RefSeq record:
XM_011512514.2
NBCI Gene record:
ECT2 (1894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512514.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047684 GCCCGTTGTATTGTACAAGTA pLKO.1 1014 CDS 100% 4.950 6.930 N ECT2 n/a
2 TRCN0000299290 GCCCGTTGTATTGTACAAGTA pLKO_005 1014 CDS 100% 4.950 6.930 N ECT2 n/a
3 TRCN0000047687 CGGAATGAACAGGATTTCTAT pLKO.1 1256 CDS 100% 5.625 4.500 N ECT2 n/a
4 TRCN0000299362 CGGAATGAACAGGATTTCTAT pLKO_005 1256 CDS 100% 5.625 4.500 N ECT2 n/a
5 TRCN0000191475 GCAGTTGATGACTTTAGAAAT pLKO.1 1280 CDS 100% 13.200 9.240 N Ect2 n/a
6 TRCN0000336437 GCAGTTGATGACTTTAGAAAT pLKO_005 1280 CDS 100% 13.200 9.240 N Ect2 n/a
7 TRCN0000047683 CCAGCAATGATAAGCATGTAA pLKO.1 3111 CDS 100% 5.625 3.938 N ECT2 n/a
8 TRCN0000299288 CCAGCAATGATAAGCATGTAA pLKO_005 3111 CDS 100% 5.625 3.938 N ECT2 n/a
9 TRCN0000047685 CGGGTTGAAACAATTTCTCTA pLKO.1 2531 CDS 100% 4.950 3.465 N ECT2 n/a
10 TRCN0000299289 CGGGTTGAAACAATTTCTCTA pLKO_005 2531 CDS 100% 4.950 3.465 N ECT2 n/a
11 TRCN0000190489 GCACAAGGTTATTGGCACTTT pLKO.1 2629 CDS 100% 4.950 2.970 N Ect2 n/a
12 TRCN0000047686 GCTGAGCATTCCCTTTCCATA pLKO.1 1727 CDS 100% 4.950 2.970 N ECT2 n/a
13 TRCN0000299365 GCTGAGCATTCCCTTTCCATA pLKO_005 1727 CDS 100% 4.950 2.970 N ECT2 n/a
14 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 396 5UTR 100% 10.800 5.400 Y MRPS16 n/a
15 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 396 5UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512514.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00474 pDONR223 100% 91.3% 88.6% None (many diffs) n/a
2 ccsbBroad304_00474 pLX_304 0% 91.3% 88.6% V5 (many diffs) n/a
3 TRCN0000477263 CTCTAGGTACCCCCTCCATGTCCC pLX_317 17.8% 91.3% 88.6% V5 (many diffs) n/a
Download CSV