Transcript: Human XM_011512612.3

PREDICTED: Homo sapiens N-acetylated alpha-linked acidic dipeptidase like 2 (NAALADL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAALADL2 (254827)
Length:
13157
CDS:
3395..5812

Additional Resources:

NCBI RefSeq record:
XM_011512612.3
NBCI Gene record:
NAALADL2 (254827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073960 CCCAACACTCATCAACTGTTA pLKO.1 5423 CDS 100% 4.950 6.930 N NAALADL2 n/a
2 TRCN0000073961 GCAAGTTCAGACAGTCACAAA pLKO.1 4678 CDS 100% 4.950 3.960 N NAALADL2 n/a
3 TRCN0000073959 GCCCTTTAATGCACTTGATAT pLKO.1 5365 CDS 100% 13.200 9.240 N NAALADL2 n/a
4 TRCN0000073962 GACCTCAATCTTGATTCCATT pLKO.1 3665 CDS 100% 4.950 3.465 N NAALADL2 n/a
5 TRCN0000073958 GCCATGTTGAAGAGTGTGTAT pLKO.1 7575 3UTR 100% 4.950 3.465 N NAALADL2 n/a
6 TRCN0000412336 AGGCAAGAAATGCACAATTAT pLKO_005 1828 5UTR 100% 15.000 7.500 Y GKAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13460 pDONR223 100% 38.3% 36.4% None (many diffs) n/a
2 ccsbBroad304_13460 pLX_304 0% 38.3% 36.4% V5 (many diffs) n/a
3 TRCN0000474341 GTTCCAGTTGCCGCGCCGGGGTGC pLX_317 42.5% 38.3% 36.4% V5 (many diffs) n/a
Download CSV