Transcript: Human XM_011512852.3

PREDICTED: Homo sapiens myeloid leukemia factor 1 (MLF1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MLF1 (4291)
Length:
1258
CDS:
287..1063

Additional Resources:

NCBI RefSeq record:
XM_011512852.3
NBCI Gene record:
MLF1 (4291)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512852.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308088 GACCGAGCTCATGTCATTAAA pLKO_005 740 CDS 100% 15.000 21.000 N MLF1 n/a
2 TRCN0000118858 CCTCAACAAAGTCCAGCCATT pLKO.1 965 CDS 100% 4.050 5.670 N MLF1 n/a
3 TRCN0000296168 GGTAGAGGGAGAGCTCATAAT pLKO_005 350 CDS 100% 13.200 10.560 N MLF1 n/a
4 TRCN0000118857 GCCATGCATTTGATTTGTTTA pLKO.1 1067 3UTR 100% 13.200 9.240 N MLF1 n/a
5 TRCN0000289181 GCCATGCATTTGATTTGTTTA pLKO_005 1067 3UTR 100% 13.200 9.240 N MLF1 n/a
6 TRCN0000118859 CCATTCTTGCACACCGAGAAA pLKO.1 264 5UTR 100% 4.950 3.465 N MLF1 n/a
7 TRCN0000307036 CCATTCTTGCACACCGAGAAA pLKO_005 264 5UTR 100% 4.950 3.465 N MLF1 n/a
8 TRCN0000118860 GACACAATCTAGGAAACACTA pLKO.1 885 CDS 100% 4.950 3.465 N MLF1 n/a
9 TRCN0000307038 GACACAATCTAGGAAACACTA pLKO_005 885 CDS 100% 4.950 3.465 N MLF1 n/a
10 TRCN0000118861 GCCATTGAACATGGAAGGAGA pLKO.1 980 CDS 100% 2.640 1.848 N MLF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512852.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01018 pDONR223 100% 85.8% 85.8% None 0_1ins75;121_165del n/a
2 ccsbBroad304_01018 pLX_304 0% 85.8% 85.8% V5 0_1ins75;121_165del n/a
3 TRCN0000468189 TCCCATAAAGTCGTAACTTTACTC pLX_317 35.1% 85.8% 85.8% V5 0_1ins75;121_165del n/a
Download CSV