Transcript: Human XM_011512873.2

PREDICTED: Homo sapiens propionyl-CoA carboxylase subunit beta (PCCB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCCB (5096)
Length:
1215
CDS:
37..1200

Additional Resources:

NCBI RefSeq record:
XM_011512873.2
NBCI Gene record:
PCCB (5096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512873.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078429 GCCCAATTATGCCAAGAACAT pLKO.1 1035 CDS 100% 4.950 3.960 N PCCB n/a
2 TRCN0000112471 GCTGCTGATAAGAATAAGTTT pLKO.1 322 CDS 100% 5.625 3.938 N Pccb n/a
3 TRCN0000078432 GCAGACATCTTTCTGAGGAAT pLKO.1 565 CDS 100% 4.950 3.465 N PCCB n/a
4 TRCN0000333416 GCAGACATCTTTCTGAGGAAT pLKO_005 565 CDS 100% 4.950 3.465 N PCCB n/a
5 TRCN0000078431 GTGGACATCATACACTCTGTT pLKO.1 985 CDS 100% 4.950 3.465 N PCCB n/a
6 TRCN0000078430 CCTTGTGTAATCTCCGGGATT pLKO.1 836 CDS 100% 4.050 2.835 N PCCB n/a
7 TRCN0000333417 CCTTGTGTAATCTCCGGGATT pLKO_005 836 CDS 100% 4.050 2.835 N PCCB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512873.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01150 pDONR223 100% 70.4% 68% None (many diffs) n/a
2 ccsbBroad304_01150 pLX_304 0% 70.4% 68% V5 (many diffs) n/a
3 TRCN0000466268 GGCCCTATAACGGGCCCAATGTCC pLX_317 13.2% 70.4% 68% V5 (many diffs) n/a
Download CSV