Transcript: Human XM_011512947.2

PREDICTED: Homo sapiens acid phosphatase, prostate (ACPP), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACP3 (55)
Length:
2155
CDS:
55..1212

Additional Resources:

NCBI RefSeq record:
XM_011512947.2
NBCI Gene record:
ACP3 (55)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002576 CACTGAGGACACCATGACTAA pLKO.1 636 CDS 100% 4.950 6.930 N ACP3 n/a
2 TRCN0000002575 GACGGAATTGTACTTTGAGAA pLKO.1 900 CDS 100% 4.950 6.930 N ACP3 n/a
3 TRCN0000355559 TATGAACTTGGAGAGTATATA pLKO_005 289 CDS 100% 15.000 10.500 N ACP3 n/a
4 TRCN0000355561 TCTTGAATGAGTCCTATAAAC pLKO_005 329 CDS 100% 13.200 9.240 N ACP3 n/a
5 TRCN0000002573 ACTCAGATACCAAGCTACAAA pLKO.1 778 CDS 100% 5.625 3.938 N ACP3 n/a
6 TRCN0000010719 GTGACTTTGGTGTTTCGGCAT pLKO.1 166 CDS 100% 2.160 1.512 N ACP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05762 pDONR223 100% 83.7% 82.5% None (many diffs) n/a
2 ccsbBroad304_05762 pLX_304 0% 83.7% 82.5% V5 (many diffs) n/a
3 TRCN0000473802 AAGTCTATCAAAAGTCCCATCACT pLX_317 31.4% 83.7% 82.5% V5 (many diffs) n/a
4 TRCN0000465247 AGGCCGCTTCAGATCCCCCCAATG pLX_317 .9% 83% 82% V5 (many diffs) n/a
5 ccsbBroadEn_05761 pDONR223 99.5% 83% 82% None (many diffs) n/a
6 ccsbBroad304_05761 pLX_304 0% 83% 82% V5 (many diffs) n/a
Download CSV