Transcript: Human XM_011512963.3

PREDICTED: Homo sapiens mitofusin 1 (MFN1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MFN1 (55669)
Length:
3105
CDS:
154..1938

Additional Resources:

NCBI RefSeq record:
XM_011512963.3
NBCI Gene record:
MFN1 (55669)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512963.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051835 GCGGCTTTCCAAGCCTAATAT pLKO.1 387 CDS 100% 15.000 21.000 N MFN1 n/a
2 TRCN0000300842 GCGGCTTTCCAAGCCTAATAT pLKO_005 387 CDS 100% 15.000 21.000 N MFN1 n/a
3 TRCN0000051834 GCCCTTCACATGGACAAAGAT pLKO.1 145 5UTR 100% 5.625 4.500 N MFN1 n/a
4 TRCN0000051833 GCTCCCATTATGATTCCAATA pLKO.1 2588 3UTR 100% 10.800 7.560 N MFN1 n/a
5 TRCN0000300841 GCTCCCATTATGATTCCAATA pLKO_005 2588 3UTR 100% 10.800 7.560 N MFN1 n/a
6 TRCN0000048421 GCCTTTAAACAGCAGTTTGTA pLKO.1 1633 CDS 100% 5.625 3.938 N LOC441511 n/a
7 TRCN0000051837 GCTCAAAGTTGTAAATGCTTT pLKO.1 513 CDS 100% 4.950 3.465 N MFN1 n/a
8 TRCN0000300765 GCTCAAAGTTGTAAATGCTTT pLKO_005 513 CDS 100% 4.950 3.465 N MFN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512963.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03626 pDONR223 100% 80.1% 80.1% None 0_1ins441 n/a
2 ccsbBroad304_03626 pLX_304 0% 80.1% 80.1% V5 0_1ins441 n/a
3 TRCN0000478631 TTTCTACTTTGAACGTAGCCTTAA pLX_317 13.9% 80.1% 80.1% V5 0_1ins441 n/a
Download CSV